Home Archives 2014

Yearly Archives: 2014

If your reader cannot render the information below, go to http://www.DrugPatentWatch.com/innovation to see the latest expirations

This newsletter is a free service of DrugPatentWatch
DrugPatentWatch offers comprehensive details on FDA approved drugs, developers, and their patents

Drug Patent Expirations for January 23 2014

TradenameApplicantGeneric NamePatent Expiration
SANDOSTATIN LAR
Novartis
octreotide acetate
Jan 23, 2014

*Drugs may be covered by multiple patents or regulatory protections. See the DrugPatentWatch database for complete details.


Instant Access to Deep Knowledge on Small-Molecule Drugs

Subscribers have access to valuable datasets, including:
  • Patent litigation
  • Clinical trial information
  • International patent data
  • Paragraph IV challenges
  • Tentative approvals
  • Drug Master Files
  • Formulation
  • Suppliers
  • Dynamic search capabilities with data export
  • More…

More than 6,400 small-molecule drugs from 1,700 branded and generic pharmaceutical companies and 700 suppliers, and more than 80,000 U.S. and international patents.

See the Database Preview and Plan Comparison. Contact Us with any questions.

The above list does not discriminate between dominant and non-dominant patents. Drugs listed above may be protected by additional patents and other regulatory protections. See the DrugPatentWatch database for complete details

DISCLAIMER:
Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided information. There is no warranty that the information contained herein is error free. Users of this service are advised to seek professional advice and independent confirmation before acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice.
All trademarks and applicant names are the property of their respective owners or licensors.

On a recent press tour of New Jersey I was introduced to PTC Therapeutics, a fascinating company that is developing ribosomal readthrough drugs for several indications.

What I find so interesting about this company and their technology is that it is a sort of magic bullet. Drugs that can modulate ribosomal activity can potentially treat hundreds of diseases (indeed, PTC told me that they are looking at thousands of diseases).

What is a ribosome, and why do you want it to “readthrough’?

Briefly, DNA contains information to construct all the proteins in our bodies. Roughly speaking, proteins are responsible for structural (e.g. muscles, skin, etc.) and chemical (e.g. digesting food, sending and responding to neurotransmitters and hormones, etc.) roles in cells. genes in DNA are transcribed into RNA, which is then translated into proteins (for a more detailed explanation, see this sample chapter from my book, Building Biotechnology).

When genetic information in RNA is being translated into proteins, sometimes there is a premature signal to stop translation. This results in a mal-formed protein which gets only partially interpreted, or discarded. The end result is that key proteins may be missing from individuals with these genetic errors, leading to sometimes terrible diseases. Fortunately, there are multiple signals for translation to stop, and the gene sequence is only one of these signals. So, companies like PTC are finding ways to modulate the activity of ribosomes, the cellular machines which translate RNA into protein, to encourage them to ignore illegitimate stop messages.

How does readthrough work?

Using the DNA-o-gram Generator, I will illustrate what a defective gene looks like, and how ribosomal readthrough can fix it.

The DNA-o-gram generator is a website that uses the principles of the genetic code to encode basic messages written in English into DNA. It can be used to demonstrate different kinds of genetic mutations.

Consider the following DNA sequence:

 CAGCTTGACTAAGCGCGTGTTCTTATGGACGCGTAACTCGGCGTCCTTGTG

In the language of the DNA-o-gram generator, it codes for the message:

Regulate glucose levels.

Now, consider what happens when we mutate the code as follows:

 CAGCTTGACTAAGTGCGTGTTCTTATGGACGCGTAACTCGGCGTCCTTGTG

The new message is:

Regu.ate glucose levels.

This is called a premature stop, because the period in the middle of the message causes it to get cut-off and destroyed. The result of the mutation in this fictional case might be loss of ability to regulate insulin, resulting in diabetes.

 

As I mentioned above, there are multiple signals to indicate stop messages, so companies like PTC are developing drugs to encourage ribosomes to address mutations

Another type of mutation is the frameshift mutation, where one or two letters in the DNA sequence is added or removed (the DNA sequence is read in threes). The result is that everything downstream of the mutation is garbled. For example:

 CAGCTTGACTAAGCCGCGTGTTCTTATGGACGCGTAACTCGGCGTCCTTGTG

is transcribed as:

Regukl51xnYrHZaW5

These are more prevalent than premature-stop mutations and will likely be far more difficult to resolve, but there are other companies focusing on developing drugs to help ribosomes address frameshifts as well.

What I find most interesting about ribosomal readthrough is that drugs addressing the errors can potential treat multiple diseases. This means that ribosomal readthrough drugs are potential ‘magic bullets,’ with the ability to be used across different conditions.

If your reader cannot render the information below, go to http://www.DrugPatentWatch.com/innovation to see the latest expirations

This newsletter is a free service of DrugPatentWatch
DrugPatentWatch offers comprehensive details on FDA approved drugs, developers, and their patents

Drug Patent Expirations for January 7 2014

TradenameApplicantGeneric NamePatent Expiration
COMBIPATCH
Novartis
estradiol; norethindrone acetate
Jan 7, 2014
GLUCOTROL XL
Pfizer
glipizide
Jan 7, 2014
MICARDIS
Boehringer Ingelheim
telmisartan
Jan 7, 2014
MICARDIS HCT
Boehringer Ingelheim
hydrochlorothiazide; telmisartan
Jan 7, 2014
MINIVELLE
Noven
estradiol
Jan 7, 2014
RAPAMUNE
Pf Prism Cv
sirolimus
Jan 7, 2014
TWYNSTA
Boehringer Ingelheim
amlodipine besylate; telmisartan
Jan 7, 2014
VIVELLE-DOT
Novartis
estradiol
Jan 7, 2014

*Drugs may be covered by multiple patents or regulatory protections. See the DrugPatentWatch database for complete details.


Instant Access to Deep Knowledge on Small-Molecule Drugs

Subscribers have access to valuable datasets, including:
  • Patent litigation
  • Clinical trial information
  • International patent data
  • Paragraph IV challenges
  • Tentative approvals
  • Drug Master Files
  • Formulation
  • Suppliers
  • Dynamic search capabilities with data export
  • More…

More than 6,400 small-molecule drugs from 1,700 branded and generic pharmaceutical companies and 700 suppliers, and more than 80,000 U.S. and international patents.

See the Database Preview and Plan Comparison. Contact Us with any questions.

The above list does not discriminate between dominant and non-dominant patents. Drugs listed above may be protected by additional patents and other regulatory protections. See the DrugPatentWatch database for complete details

DISCLAIMER:
Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided information. There is no warranty that the information contained herein is error free. Users of this service are advised to seek professional advice and independent confirmation before acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice.
All trademarks and applicant names are the property of their respective owners or licensors.

If your reader cannot render the information below, go to http://www.DrugPatentWatch.com/innovation to see the latest expirations

This newsletter is a free service of DrugPatentWatch
DrugPatentWatch offers comprehensive details on FDA approved drugs, developers, and their patents

Drug Patent Expirations for January 15 2014

TradenameApplicantGeneric NamePatent Expiration
PRECEDEX
Hospira
dexmedetomidine hydrochloride
Jan 15, 2014

*Drugs may be covered by multiple patents or regulatory protections. See the DrugPatentWatch database for complete details.


Instant Access to Deep Knowledge on Small-Molecule Drugs

Subscribers have access to valuable datasets, including:
  • Patent litigation
  • Clinical trial information
  • International patent data
  • Paragraph IV challenges
  • Tentative approvals
  • Drug Master Files
  • Formulation
  • Suppliers
  • Dynamic search capabilities with data export
  • More…

More than 6,400 small-molecule drugs from 1,700 branded and generic pharmaceutical companies and 700 suppliers, and more than 80,000 U.S. and international patents.

See the Database Preview and Plan Comparison. Contact Us with any questions.

The above list does not discriminate between dominant and non-dominant patents. Drugs listed above may be protected by additional patents and other regulatory protections. See the DrugPatentWatch database for complete details

DISCLAIMER:
Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided information. There is no warranty that the information contained herein is error free. Users of this service are advised to seek professional advice and independent confirmation before acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice.
All trademarks and applicant names are the property of their respective owners or licensors.

Journal of Commercial Biotechnology This paper is part of the free Open Access archive of the Journal of Commercial Biotechnology

Seeds, food and trade wars: Public opinion and policy responses in the USA and Europe

Go to paper

ABSTRACT: The political debate over genetically modified foods entered a new phase when the USA (under the Bush Administration) threatened legal actions within the World Trade Organization (WTO) against a moratorium of these products in the European Union. This paper focuses on developing a societal context in which these political disputes arose though an investigation of public opinion polls conducted in both the USA and Europe...

The Journal of Commercial Biotechnology is a unique forum for all those involved in biotechnology commercialization to present, share, and explore new ideas, latest thinking and best practices, making it an indispensable guide for those developing projects and careers within this fast moving field.

Each issue publishes peer-reviewed, authoritative, cutting-edge articles written by the leading practitioners and researchers in the field, addressing topics such as:

  • Management
  • Policy
  • Finance
  • Law
  • Regulation
  • Bioethics

For more information, see the Journal of Commercial Biotechnology website

If your reader cannot render the information below, go to http://www.DrugPatentWatch.com/innovation to see the latest expirations

This newsletter is a free service of DrugPatentWatch
DrugPatentWatch offers comprehensive details on FDA approved drugs, developers, and their patents

Drug Patent Expirations for January 9 2014

TradenameApplicantGeneric NamePatent Expiration
ATACAND
Astrazeneca
candesartan cilexetil
Jan 9, 2014
ATACAND HCT
Astrazeneca
candesartan cilexetil; hydrochlorothiazide
Jan 9, 2014

*Drugs may be covered by multiple patents or regulatory protections. See the DrugPatentWatch database for complete details.


Instant Access to Deep Knowledge on Small-Molecule Drugs

Subscribers have access to valuable datasets, including:
  • Patent litigation
  • Clinical trial information
  • International patent data
  • Paragraph IV challenges
  • Tentative approvals
  • Drug Master Files
  • Formulation
  • Suppliers
  • Dynamic search capabilities with data export
  • More…

More than 6,400 small-molecule drugs from 1,700 branded and generic pharmaceutical companies and 700 suppliers, and more than 80,000 U.S. and international patents.

See the Database Preview and Plan Comparison. Contact Us with any questions.

The above list does not discriminate between dominant and non-dominant patents. Drugs listed above may be protected by additional patents and other regulatory protections. See the DrugPatentWatch database for complete details

DISCLAIMER:
Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided information. There is no warranty that the information contained herein is error free. Users of this service are advised to seek professional advice and independent confirmation before acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice.
All trademarks and applicant names are the property of their respective owners or licensors.

If your reader cannot render the information below, go to http://www.DrugPatentWatch.com/innovation to see the latest expirations

This newsletter is a free service of DrugPatentWatch
DrugPatentWatch offers comprehensive details on FDA approved drugs, developers, and their patents

Drug Patent Expirations for January 2 2014

TradenameApplicantGeneric NamePatent Expiration
EPIVIR-HBV
Glaxosmithkline
lamivudine
Jan 2, 2014

*Drugs may be covered by multiple patents or regulatory protections. See the DrugPatentWatch database for complete details.


Instant Access to Deep Knowledge on Small-Molecule Drugs

Subscribers have access to valuable datasets, including:
  • Patent litigation
  • Clinical trial information
  • International patent data
  • Paragraph IV challenges
  • Tentative approvals
  • Drug Master Files
  • Formulation
  • Suppliers
  • Dynamic search capabilities with data export
  • More…

More than 6,400 small-molecule drugs from 1,700 branded and generic pharmaceutical companies and 700 suppliers, and more than 80,000 U.S. and international patents.

See the Database Preview and Plan Comparison. Contact Us with any questions.

The above list does not discriminate between dominant and non-dominant patents. Drugs listed above may be protected by additional patents and other regulatory protections. See the DrugPatentWatch database for complete details

DISCLAIMER:
Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided information. There is no warranty that the information contained herein is error free. Users of this service are advised to seek professional advice and independent confirmation before acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice.
All trademarks and applicant names are the property of their respective owners or licensors.

Drug Patent Expirations for January 2014

TradenameApplicantGeneric NamePatent NumberPatent Expiration
EPIVIR-HBVGlaxosmithklinelamivudineRE39155*PEDJan 2, 2014
MICARDISBoehringer Ingelheimtelmisartan5,591,762Jan 7, 2014
TWYNSTABoehringer Ingelheimamlodipine besylate; telmisartan5,591,762Jan 7, 2014
COMBIPATCHNovartisestradiol; norethindrone acetate6,024,976Jan 7, 2014
GLUCOTROL XLPfizerglipizide5,591,454Jan 7, 2014
VIVELLE-DOTNovartisestradiol6,024,976Jan 7, 2014
MICARDIS HCTBoehringer Ingelheimhydrochlorothiazide; telmisartan5,591,762Jan 7, 2014
RAPAMUNEPf Prism Cvsirolimus5,100,899*PEDJan 7, 2014
MINIVELLENovenestradiol6,024,976Jan 7, 2014
ATACANDAstrazenecacandesartan cilexetil5,534,534*PEDJan 9, 2014
ATACAND HCTAstrazenecacandesartan cilexetil; hydrochlorothiazide5,534,534*PEDJan 9, 2014
PRECEDEXHospiradexmedetomidine hydrochloride4,910,214*PEDJan 15, 2014
SANDOSTATIN LARNovartisoctreotide acetate5,538,739*PEDJan 23, 2014
XYZALUcb Inclevocetirizine dihydrochloride5,698,558*PEDJan 26, 2014
DULERAMerck Sharp Dohmeformoterol fumarate; mometasone furoate6,677,323Jan 27, 2014
NORVIRAbbottritonavir5,541,206*PEDJan 30, 2014
NORVIRAbbvieritonavir5,635,523*PEDJan 30, 2014
KALETRAAbbvielopinavir; ritonavir5,541,206*PEDJan 30, 2014
NORVIRAbbvieritonavir5,541,206*PEDJan 30, 2014
NORVIRAbbvieritonavir5,674,882*PEDJan 30, 2014
BETAXONAlcon Pharms Ltdlevobetaxolol hydrochloride5,540,918*PEDJan 30, 2014
*Drugs may be covered by multiple patents or regulatory protections. See the DrugPatentWatch database for complete details.

Subscribers have access to valuable datasets, including:

  • Clinical trial information
  • International patent families
  • International patent priority and PCT information
  • Patent maintenance
  • Full-text patent downloads
  • Sales data (top 200 drugs)
  • Paragraph IV challenges
  • Tentative approvals
  • Dynamic search capabilities with data export
  • More…
See the Database Preview and Plan Comparison.
Contact Us with any questions.

In the wake of the repositioning of Maryland’s Shady Grove Incubator from biotechnology to cyber security, Virginia has stepped up with a new biotechnology incubator.

The Prince William Science Accelerator, located adjacent to George Mason University, will be the only public-private commercially available property featuring wet laboratory spaces in the Northern Virginia region for the life sciences.

Maryland has long been a stronghold of biotechnology in the DC area, and it will be interesting to see if this repositioning of assets will help drive more biotechnology development in northern Virginia.

If your reader cannot render the information below, go to http://www.DrugPatentWatch.com/innovation to see the latest expirations

This newsletter is a free service of DrugPatentWatch
DrugPatentWatch offers comprehensive details on FDA approved drugs, developers, and their patents

Drug Patent Expirations for December 28 2013

TradenameApplicantGeneric NamePatent Expiration
EFFEXOR XR
Wyeth Pharms Inc
venlafaxine hydrochloride
Dec 28, 2013

*Drugs may be covered by multiple patents or regulatory protections. See the DrugPatentWatch database for complete details.


Instant Access to Deep Knowledge on Small-Molecule Drugs

Subscribers have access to valuable datasets, including:
  • Patent litigation
  • Clinical trial information
  • International patent data
  • Paragraph IV challenges
  • Tentative approvals
  • Drug Master Files
  • Formulation
  • Suppliers
  • Dynamic search capabilities with data export
  • More…

More than 6,400 small-molecule drugs from 1,700 branded and generic pharmaceutical companies and 700 suppliers, and more than 80,000 U.S. and international patents.

See the Database Preview and Plan Comparison. Contact Us with any questions.

The above list does not discriminate between dominant and non-dominant patents. Drugs listed above may be protected by additional patents and other regulatory protections. See the DrugPatentWatch database for complete details

DISCLAIMER:
Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided information. There is no warranty that the information contained herein is error free. Users of this service are advised to seek professional advice and independent confirmation before acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice.
All trademarks and applicant names are the property of their respective owners or licensors.