Home Archives 2014

Yearly Archives: 2014

SteveSapletalThis is a guest post by Steve Sapletal,  a director in West Monroe Partners‘ M&A practice. Do you have a response to Steve’s post? Respond in the comments section below.

Reorganize, realign, refocus: When divesting is the key to improving margins and profitability

Large medical device companies have been buying complementary businesses over the last five to seven years in order to grow the bottom line while achieving better margins and improving profitability. But, while these organizations have been quick to acquire, many have since realized that operating these complementary organizations requires an entirely different business focus, customer support and operating model. Sometimes, this realization comes too late, resulting in employee and customer retention issues, shrinking revenues and profit margins instead of the bottom line growth and collaborative opportunities the deal promised initially. In these instances, large medical device companies’ best bet is to consider consolidating operations or selling non-strategic parts of their business to refocus on their core operations.

One organization doing just that is Quest Diagnostics. In late 2012, Quest Diagnostics announced that it would launch “a major management restructuring aimed at driving operational excellence and restoring growth.” This restructuring was intended to simplify the organization by divesting non-core and underperforming assets and refocusing capital deployment.  Since then, Quest Diagnostics has reorganized numerous times, shuffled many of its products and services, realigned employees, eliminated duplicative roles and layers of management and adopted a simple “back to basics” approach.  Quest has also sold parts of the business, including HemoCue, to shift attention back to its core operations in diagnostic information services.

Divesting companies takes time, energy and resources and has an immediate impact on profitability. But, it also allows medical device companies like Quest to dedicate the right resources and capital to its strategic objectives going forward. It is a tough decision to divest a portion of the business, especially given shareholder pressures to increase share value, but is often the right one for medical device companies looking for long-term survival and prosperity in an industry ripe with competition.

When should a large medical device company consider refocusing on core operations?

Acquisitions always look good on paper and in a financial model, but achieving full integration and deal value is not a paper exercise.  When completing multiple deals within a year, organizations tend to experience new layers of management and reporting structures, duplicate core IT systems and redundant business processes. After a period of high transaction activity, Quest realized that it had three extra layers of management between the CEO and front line employees that were unnecessary –representing between 400 and 600 employees – far beyond what one would deem a well-run organizational model.

Additionally, Quest, like many of its peers, had to respond to new market pressures regarding reimbursement for laboratory diagnostic services by shuffling their product and services portfolios to stay profitable.  Internally, Quest needed to simplify operations and improve processes to be able to respond more quickly to customer requests and make decisions faster. Many of these bottlenecks were the result of previously acquired businesses not being fully integrated into overall operations. While there is never a perfect time to go through the process of refocusing your business, waiting too long to consolidate or divest can ultimately stunt your business’s growth in the long-term.

What’s next?

Selling business units and consolidating divisions doesn’t guarantee operational excellence. Putting the right organizational structure in place is only step one towards achieving your strategic objectives. From there, medical device companies should pay careful attention to broken, inefficient or outdated systems and technologies. Address these problem areas to ensure they promote productivity and design the right processes to complement these systems. Careful planning is important, but successful execution is vital.

Look for Quest to spend a large chuck of time, resources and dollars to stabilize the business before strategically buying another large business outside of its core competency.

About the guest-author:

Steve Sapletal is a director in West Monroe’s M&A practice. He can be reached at ssapletal@westmonroepartners.com.

I have created a six-hour biotechnology education series at bit.ly/LfbSdS, and I want to highlight the policy discussion here.

It is easy to ignore policy when operating in biotechnology. The importance of an understanding of the business of biotechnology, of patent and other legal issues, and of the science of biotechnology is clear, but it is not sufficient to focus on these to the exclusion of policy. For it is policy that determines crucial elements such as research funding, incentives for biotechnology commercialization, and even the strength of patent laws.

So, I present this three-part video series to provide an overview of biotechnology policy, to illustrate how policies can promote biotechnology, and to demonstrate the challenges of balancing innovation incentives with economic constraints.

I have created a six-hour biotechnology education series at bit.ly/LfbSdS, and I want to highlight the policy discussion here.

It is easy to ignore policy when operating in biotechnology. The importance of an understanding of the business of biotechnology, of patent and other legal issues, and of the science of biotechnology is clear, but it is not sufficient to focus on these to the exclusion of policy. For it is policy that determines crucial elements such as research funding, incentives for biotechnology commercialization, and even the strength of patent laws.

So, I present this three-part video series to provide an overview of biotechnology policy, to illustrate how policies can promote biotechnology, and to demonstrate the challenges of balancing innovation incentives with economic constraints.

I have created a six-hour biotechnology education series at bit.ly/LfbSdS, and I want to highlight the policy discussion here.

It is easy to ignore policy when operating in biotechnology. The importance of an understanding of the business of biotechnology, of patent and other legal issues, and of the science of biotechnology is clear, but it is not sufficient to focus on these to the exclusion of policy. For it is policy that determines crucial elements such as research funding, incentives for biotechnology commercialization, and even the strength of patent laws.

So, I present this three-part video series to provide an overview of biotechnology policy, to illustrate how policies can promote biotechnology, and to demonstrate the challenges of balancing innovation incentives with economic constraints.

If your reader cannot render the information below, go to http://www.DrugPatentWatch.com/innovation to see the latest expirations

This newsletter is a free service of DrugPatentWatch
DrugPatentWatch offers comprehensive details on FDA approved drugs, developers, and their patents

Drug Patent Expirations for January 27 2014

TradenameApplicantGeneric NamePatent Expiration
DULERA
Merck Sharp Dohme
formoterol fumarate; mometasone furoate
Jan 27, 2014

*Drugs may be covered by multiple patents or regulatory protections. See the DrugPatentWatch database for complete details.


Instant Access to Deep Knowledge on Small-Molecule Drugs

Subscribers have access to valuable datasets, including:
  • Patent litigation
  • Clinical trial information
  • International patent data
  • Paragraph IV challenges
  • Tentative approvals
  • Drug Master Files
  • Formulation
  • Suppliers
  • Dynamic search capabilities with data export
  • More…

More than 6,400 small-molecule drugs from 1,700 branded and generic pharmaceutical companies and 700 suppliers, and more than 80,000 U.S. and international patents.

See the Database Preview and Plan Comparison. Contact Us with any questions.

The above list does not discriminate between dominant and non-dominant patents. Drugs listed above may be protected by additional patents and other regulatory protections. See the DrugPatentWatch database for complete details

DISCLAIMER:
Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided information. There is no warranty that the information contained herein is error free. Users of this service are advised to seek professional advice and independent confirmation before acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice.
All trademarks and applicant names are the property of their respective owners or licensors.

If your reader cannot render the information below, go to http://www.DrugPatentWatch.com/innovation to see the latest expirations

This newsletter is a free service of DrugPatentWatch
DrugPatentWatch offers comprehensive details on FDA approved drugs, developers, and their patents

Drug Patent Expirations for January 26 2014

TradenameApplicantGeneric NamePatent Expiration
XYZAL
Ucb Inc
levocetirizine dihydrochloride
Jan 26, 2014

*Drugs may be covered by multiple patents or regulatory protections. See the DrugPatentWatch database for complete details.


Instant Access to Deep Knowledge on Small-Molecule Drugs

Subscribers have access to valuable datasets, including:
  • Patent litigation
  • Clinical trial information
  • International patent data
  • Paragraph IV challenges
  • Tentative approvals
  • Drug Master Files
  • Formulation
  • Suppliers
  • Dynamic search capabilities with data export
  • More…

More than 6,400 small-molecule drugs from 1,700 branded and generic pharmaceutical companies and 700 suppliers, and more than 80,000 U.S. and international patents.

See the Database Preview and Plan Comparison. Contact Us with any questions.

The above list does not discriminate between dominant and non-dominant patents. Drugs listed above may be protected by additional patents and other regulatory protections. See the DrugPatentWatch database for complete details

DISCLAIMER:
Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided information. There is no warranty that the information contained herein is error free. Users of this service are advised to seek professional advice and independent confirmation before acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice.
All trademarks and applicant names are the property of their respective owners or licensors.

If your reader cannot render the information below, go to http://www.DrugPatentWatch.com/innovation to see the latest expirations

This newsletter is a free service of DrugPatentWatch
DrugPatentWatch offers comprehensive details on FDA approved drugs, developers, and their patents

Drug Patent Expirations for January 23 2014

TradenameApplicantGeneric NamePatent Expiration
SANDOSTATIN LAR
Novartis
octreotide acetate
Jan 23, 2014

*Drugs may be covered by multiple patents or regulatory protections. See the DrugPatentWatch database for complete details.


Instant Access to Deep Knowledge on Small-Molecule Drugs

Subscribers have access to valuable datasets, including:
  • Patent litigation
  • Clinical trial information
  • International patent data
  • Paragraph IV challenges
  • Tentative approvals
  • Drug Master Files
  • Formulation
  • Suppliers
  • Dynamic search capabilities with data export
  • More…

More than 6,400 small-molecule drugs from 1,700 branded and generic pharmaceutical companies and 700 suppliers, and more than 80,000 U.S. and international patents.

See the Database Preview and Plan Comparison. Contact Us with any questions.

The above list does not discriminate between dominant and non-dominant patents. Drugs listed above may be protected by additional patents and other regulatory protections. See the DrugPatentWatch database for complete details

DISCLAIMER:
Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided information. There is no warranty that the information contained herein is error free. Users of this service are advised to seek professional advice and independent confirmation before acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice.
All trademarks and applicant names are the property of their respective owners or licensors.

On a recent press tour of New Jersey I was introduced to PTC Therapeutics, a fascinating company that is developing ribosomal readthrough drugs for several indications.

What I find so interesting about this company and their technology is that it is a sort of magic bullet. Drugs that can modulate ribosomal activity can potentially treat hundreds of diseases (indeed, PTC told me that they are looking at thousands of diseases).

What is a ribosome, and why do you want it to “readthrough’?

Briefly, DNA contains information to construct all the proteins in our bodies. Roughly speaking, proteins are responsible for structural (e.g. muscles, skin, etc.) and chemical (e.g. digesting food, sending and responding to neurotransmitters and hormones, etc.) roles in cells. genes in DNA are transcribed into RNA, which is then translated into proteins (for a more detailed explanation, see this sample chapter from my book, Building Biotechnology).

When genetic information in RNA is being translated into proteins, sometimes there is a premature signal to stop translation. This results in a mal-formed protein which gets only partially interpreted, or discarded. The end result is that key proteins may be missing from individuals with these genetic errors, leading to sometimes terrible diseases. Fortunately, there are multiple signals for translation to stop, and the gene sequence is only one of these signals. So, companies like PTC are finding ways to modulate the activity of ribosomes, the cellular machines which translate RNA into protein, to encourage them to ignore illegitimate stop messages.

How does readthrough work?

Using the DNA-o-gram Generator, I will illustrate what a defective gene looks like, and how ribosomal readthrough can fix it.

The DNA-o-gram generator is a website that uses the principles of the genetic code to encode basic messages written in English into DNA. It can be used to demonstrate different kinds of genetic mutations.

Consider the following DNA sequence:

 CAGCTTGACTAAGCGCGTGTTCTTATGGACGCGTAACTCGGCGTCCTTGTG

In the language of the DNA-o-gram generator, it codes for the message:

Regulate glucose levels.

Now, consider what happens when we mutate the code as follows:

 CAGCTTGACTAAGTGCGTGTTCTTATGGACGCGTAACTCGGCGTCCTTGTG

The new message is:

Regu.ate glucose levels.

This is called a premature stop, because the period in the middle of the message causes it to get cut-off and destroyed. The result of the mutation in this fictional case might be loss of ability to regulate insulin, resulting in diabetes.

 

As I mentioned above, there are multiple signals to indicate stop messages, so companies like PTC are developing drugs to encourage ribosomes to address mutations

Another type of mutation is the frameshift mutation, where one or two letters in the DNA sequence is added or removed (the DNA sequence is read in threes). The result is that everything downstream of the mutation is garbled. For example:

 CAGCTTGACTAAGCCGCGTGTTCTTATGGACGCGTAACTCGGCGTCCTTGTG

is transcribed as:

Regukl51xnYrHZaW5

These are more prevalent than premature-stop mutations and will likely be far more difficult to resolve, but there are other companies focusing on developing drugs to help ribosomes address frameshifts as well.

What I find most interesting about ribosomal readthrough is that drugs addressing the errors can potential treat multiple diseases. This means that ribosomal readthrough drugs are potential ‘magic bullets,’ with the ability to be used across different conditions.

If your reader cannot render the information below, go to http://www.DrugPatentWatch.com/innovation to see the latest expirations

This newsletter is a free service of DrugPatentWatch
DrugPatentWatch offers comprehensive details on FDA approved drugs, developers, and their patents

Drug Patent Expirations for January 7 2014

TradenameApplicantGeneric NamePatent Expiration
COMBIPATCH
Novartis
estradiol; norethindrone acetate
Jan 7, 2014
GLUCOTROL XL
Pfizer
glipizide
Jan 7, 2014
MICARDIS
Boehringer Ingelheim
telmisartan
Jan 7, 2014
MICARDIS HCT
Boehringer Ingelheim
hydrochlorothiazide; telmisartan
Jan 7, 2014
MINIVELLE
Noven
estradiol
Jan 7, 2014
RAPAMUNE
Pf Prism Cv
sirolimus
Jan 7, 2014
TWYNSTA
Boehringer Ingelheim
amlodipine besylate; telmisartan
Jan 7, 2014
VIVELLE-DOT
Novartis
estradiol
Jan 7, 2014

*Drugs may be covered by multiple patents or regulatory protections. See the DrugPatentWatch database for complete details.


Instant Access to Deep Knowledge on Small-Molecule Drugs

Subscribers have access to valuable datasets, including:
  • Patent litigation
  • Clinical trial information
  • International patent data
  • Paragraph IV challenges
  • Tentative approvals
  • Drug Master Files
  • Formulation
  • Suppliers
  • Dynamic search capabilities with data export
  • More…

More than 6,400 small-molecule drugs from 1,700 branded and generic pharmaceutical companies and 700 suppliers, and more than 80,000 U.S. and international patents.

See the Database Preview and Plan Comparison. Contact Us with any questions.

The above list does not discriminate between dominant and non-dominant patents. Drugs listed above may be protected by additional patents and other regulatory protections. See the DrugPatentWatch database for complete details

DISCLAIMER:
Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided information. There is no warranty that the information contained herein is error free. Users of this service are advised to seek professional advice and independent confirmation before acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice.
All trademarks and applicant names are the property of their respective owners or licensors.

If your reader cannot render the information below, go to http://www.DrugPatentWatch.com/innovation to see the latest expirations

This newsletter is a free service of DrugPatentWatch
DrugPatentWatch offers comprehensive details on FDA approved drugs, developers, and their patents

Drug Patent Expirations for January 15 2014

TradenameApplicantGeneric NamePatent Expiration
PRECEDEX
Hospira
dexmedetomidine hydrochloride
Jan 15, 2014

*Drugs may be covered by multiple patents or regulatory protections. See the DrugPatentWatch database for complete details.


Instant Access to Deep Knowledge on Small-Molecule Drugs

Subscribers have access to valuable datasets, including:
  • Patent litigation
  • Clinical trial information
  • International patent data
  • Paragraph IV challenges
  • Tentative approvals
  • Drug Master Files
  • Formulation
  • Suppliers
  • Dynamic search capabilities with data export
  • More…

More than 6,400 small-molecule drugs from 1,700 branded and generic pharmaceutical companies and 700 suppliers, and more than 80,000 U.S. and international patents.

See the Database Preview and Plan Comparison. Contact Us with any questions.

The above list does not discriminate between dominant and non-dominant patents. Drugs listed above may be protected by additional patents and other regulatory protections. See the DrugPatentWatch database for complete details

DISCLAIMER:
Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided information. There is no warranty that the information contained herein is error free. Users of this service are advised to seek professional advice and independent confirmation before acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice.
All trademarks and applicant names are the property of their respective owners or licensors.