Are Ribosomal Readthrough Drugs the Next Biotech Magic Bullet?

On a recent press tour of New Jersey I was introduced to PTC Therapeutics, a fascinating company that is developing ribosomal readthrough drugs for several indications.

What I find so interesting about this company and their technology is that it is a sort of magic bullet. Drugs that can modulate ribosomal activity can potentially treat hundreds of diseases (indeed, PTC told me that they are looking at thousands of diseases).

What is a ribosome, and why do you want it to “readthrough’?

Briefly, DNA contains information to construct all the proteins in our bodies. Roughly speaking, proteins are responsible for structural (e.g. muscles, skin, etc.) and chemical (e.g. digesting food, sending and responding to neurotransmitters and hormones, etc.) roles in cells. genes in DNA are transcribed into RNA, which is then translated into proteins (for a more detailed explanation, see this sample chapter from my book, Building Biotechnology).

When genetic information in RNA is being translated into proteins, sometimes there is a premature signal to stop translation. This results in a mal-formed protein which gets only partially interpreted, or discarded. The end result is that key proteins may be missing from individuals with these genetic errors, leading to sometimes terrible diseases. Fortunately, there are multiple signals for translation to stop, and the gene sequence is only one of these signals. So, companies like PTC are finding ways to modulate the activity of ribosomes, the cellular machines which translate RNA into protein, to encourage them to ignore illegitimate stop messages.

How does readthrough work?

Using the DNA-o-gram Generator, I will illustrate what a defective gene looks like, and how ribosomal readthrough can fix it.

The DNA-o-gram generator is a website that uses the principles of the genetic code to encode basic messages written in English into DNA. It can be used to demonstrate different kinds of genetic mutations.

Consider the following DNA sequence:

 CAGCTTGACTAAGCGCGTGTTCTTATGGACGCGTAACTCGGCGTCCTTGTG

In the language of the DNA-o-gram generator, it codes for the message:

Regulate glucose levels.

Now, consider what happens when we mutate the code as follows:

 CAGCTTGACTAAGTGCGTGTTCTTATGGACGCGTAACTCGGCGTCCTTGTG

The new message is:

Regu.ate glucose levels.

This is called a premature stop, because the period in the middle of the message causes it to get cut-off and destroyed. The result of the mutation in this fictional case might be loss of ability to regulate insulin, resulting in diabetes.

As I mentioned above, there are multiple signals to indicate stop messages, so companies like PTC are developing drugs to encourage ribosomes to address mutations

Another type of mutation is the frameshift mutation, where one or two letters in the DNA sequence is added or removed (the DNA sequence is read in threes). The result is that everything downstream of the mutation is garbled. For example:

 CAGCTTGACTAAGCCGCGTGTTCTTATGGACGCGTAACTCGGCGTCCTTGTG

is transcribed as:

Regukl51xnYrHZaW5

These are more prevalent than premature-stop mutations and will likely be far more difficult to resolve, but there are other companies focusing on developing drugs to help ribosomes address frameshifts as well.

What I find most interesting about ribosomal readthrough is that drugs addressing the errors can potential treat multiple diseases. This means that ribosomal readthrough drugs are potential ‘magic bullets,’ with the ability to be used across different conditions.

Comments are closed.