Six years ago I built a global biotechnology innovation index, and I have been using it since tracking global biotechnology innovation in Scientific American’s Worldview. It has been a very rewarding project, and I have enjoyed the opportunity to present my research data at international conferences, business schools, and even National Defense University.
Some of the issues I am focusing on this year are economic recovery, agricultural biotechnology, and global biotechnology workforce intensity and mobility.
I am always looking for feedback on the index and new data sets to help expand it. I invite you to visit the scorecard at http://www.saworldview.com/wv/scorecard/ and send me your suggestions and feedback.
The 1980 Supreme Court case of Diamond v. Chakrabarty was transformative for the biotechnology industry. It saw the Supreme Court allow Ananda Chakrabarty’s patents on living organisms, and paved the way for commercial biotechnology.
Decades later, Chakrabarty is still an active researcher, and he is now working to develop cancer therapeutics based on symbiotic bacteria. In Bugging Cancer, Chakrabarty and his colleagues at the Chicago Oncogroup have written a compelling dramatic thriller that portrays a fictional story based on this real-life work.
Bugging Cancer is a fictional book, based on real scientific progress in using bacteria and bacterial proteins to attack malignant tumor cells. Scientific results are extended in a fictional way to describe the cancer-fighting power of an imaginary bacterial protein termed neelazin. The book also mirrors present-day issues, including international competition for scientific talent, issues in patent law, research ethics, and financing.
Written by a team of seasoned scientific and business professionals, Bugging Cancer is sure to appeal to scientific researchers, patent attorneys, physicians, and any anyone else interested in healthcare and scientific innovation.
See more details at the book’s homepage, or buy it at Amazon.com
In a recent post at In the Pipeline, Derek Lowe answers a reader’s question about how best to promote drug discover in India. Given my research on the matter, I figured I would try and provide an answer as well.
In Scientific American’s Worldview, I have been ranking national biotechnology industries for the past five years. When I was recently in New Delhi I presented the Indian innovation figures and asked the audience to guess where they ranked. Much to their amazement, India was ranked with the bottom five of the 50+ countries assessed. The issues are myriad — poor patent protection, infrastructure problems, an insufficient quantity (not quality!) of skilled workers, etc.
Compounding this issue, I also refer back to my study on pharmaceutical globalization (see also peer-reviewed publication). When studying the locations of pharmaceutical patent inventors since 2000, I was surprised to find that it had essentially never moved — The US, Western Europe, and Japan have and still do dominate pharmaceutical invention. This is a sobering finding for any region (either a country or even a province/state within one) seeking to improve their drug discovery output. It is notoriously hard to seed new locations.
So, where does that leave India and every other country that doesn’t have strong drug discovery? Should they simply give up? Clearly that is not a good plan, and it is also not practical because of the strong social, economic and political benefits that come from drug discovery. Rather, I think that countries seeking to develop drug discovery capacity should focus first on building foundations for drug discovery, and this is often best done by not working on drugs!
One of the problems with providing stimulus to foster novel drug development firms is that, if successful, the talent, products, and profits often move to one of the established drug development hubs. It is akin to trying to build an broadcast entertainment industry outside Hollywood or developing a sports team in a new city — if you do develop talent, much of it will be drawn to the existing hubs.
So, given that successfully developing drugs outside of existing hubs has been shown to be rare, and that any products and talent developed outside of existing hubs is also likely to relocate to existing hubs, what can be done? I think that a better approach is to focus on uniquely domestic needs, which can be later adapted to serve broader problems.
Brazil is a world leader in bioethanol production. This capacity was developed with the initial help of tax subsidies, but it also followed a natural path — sugarcane processing. In Brazil bioethanol is produced by fermentation of bagasse, which is the pulpy sugarcane plant mass left behind after sugar extraction. Because bagasse was already collected at sugar processing plants, biomass producers simply had to set up shop at the collection points. Furthermore, because bagasse is expensive to ship, it means that the bioethanol companies are likely to stay local.
To come back to the Indian example, it is important to recognize that drugs are but one way to improve health. Another way is to prevent disease. When I was in New Delhi, holidays were providing a respite from smog as farmers upwind from Delhi had temporarily stopped burning crop residues. Investments in industrial or agricultural biotechnology applications to provide alternatives to burning crop residues can improve rural employment while reducing pollution and pollution-borne illnesses. These domestic solutions are unlikely to relocate, and can build a foundation for further development in other areas, such therapeutic biotechnology.
This paper is part of the free Open Access archive of the Journal of Commercial Biotechnology
ABSTRACT: This paper reviews the law on the doctrine of equivalence and prosecution history estoppel and explores how it has been reshaped by the Federal Circuit's and Supreme Court's decisions in Festo Corp. v Shoketsu Kinzoku Kogyo Kabushiki Co., Ltd. The paper also assesses the likely impact those decisions will have on patent prosecution, licensing and enforcement activities.
The Journal of Commercial Biotechnology is a unique forum for all those involved in biotechnology commercialization to present, share, and explore new ideas, latest thinking and best practices, making it an indispensable guide for those developing projects and careers within this fast moving field.
Each issue publishes peer-reviewed, authoritative, cutting-edge articles written by the leading practitioners and researchers in the field, addressing topics such as:
For more information, see the Journal of Commercial Biotechnology website
This is a guest post by Steve Sapletal, a director in West Monroe Partners‘ M&A practice. Do you have a response to Steve’s post? Respond in the comments section below.
Large medical device companies have been buying complementary businesses over the last five to seven years in order to grow the bottom line while achieving better margins and improving profitability. But, while these organizations have been quick to acquire, many have since realized that operating these complementary organizations requires an entirely different business focus, customer support and operating model. Sometimes, this realization comes too late, resulting in employee and customer retention issues, shrinking revenues and profit margins instead of the bottom line growth and collaborative opportunities the deal promised initially. In these instances, large medical device companies’ best bet is to consider consolidating operations or selling non-strategic parts of their business to refocus on their core operations.
One organization doing just that is Quest Diagnostics. In late 2012, Quest Diagnostics announced that it would launch “a major management restructuring aimed at driving operational excellence and restoring growth.” This restructuring was intended to simplify the organization by divesting non-core and underperforming assets and refocusing capital deployment. Since then, Quest Diagnostics has reorganized numerous times, shuffled many of its products and services, realigned employees, eliminated duplicative roles and layers of management and adopted a simple “back to basics” approach. Quest has also sold parts of the business, including HemoCue, to shift attention back to its core operations in diagnostic information services.
Divesting companies takes time, energy and resources and has an immediate impact on profitability. But, it also allows medical device companies like Quest to dedicate the right resources and capital to its strategic objectives going forward. It is a tough decision to divest a portion of the business, especially given shareholder pressures to increase share value, but is often the right one for medical device companies looking for long-term survival and prosperity in an industry ripe with competition.
Acquisitions always look good on paper and in a financial model, but achieving full integration and deal value is not a paper exercise. When completing multiple deals within a year, organizations tend to experience new layers of management and reporting structures, duplicate core IT systems and redundant business processes. After a period of high transaction activity, Quest realized that it had three extra layers of management between the CEO and front line employees that were unnecessary –representing between 400 and 600 employees – far beyond what one would deem a well-run organizational model.
Additionally, Quest, like many of its peers, had to respond to new market pressures regarding reimbursement for laboratory diagnostic services by shuffling their product and services portfolios to stay profitable. Internally, Quest needed to simplify operations and improve processes to be able to respond more quickly to customer requests and make decisions faster. Many of these bottlenecks were the result of previously acquired businesses not being fully integrated into overall operations. While there is never a perfect time to go through the process of refocusing your business, waiting too long to consolidate or divest can ultimately stunt your business’s growth in the long-term.
Selling business units and consolidating divisions doesn’t guarantee operational excellence. Putting the right organizational structure in place is only step one towards achieving your strategic objectives. From there, medical device companies should pay careful attention to broken, inefficient or outdated systems and technologies. Address these problem areas to ensure they promote productivity and design the right processes to complement these systems. Careful planning is important, but successful execution is vital.
Look for Quest to spend a large chuck of time, resources and dollars to stabilize the business before strategically buying another large business outside of its core competency.
About the guest-author:
Steve Sapletal is a director in West Monroe’s M&A practice. He can be reached at ssapletal@westmonroepartners.com.
I have created a six-hour biotechnology education series at bit.ly/LfbSdS, and I want to highlight the policy discussion here.
It is easy to ignore policy when operating in biotechnology. The importance of an understanding of the business of biotechnology, of patent and other legal issues, and of the science of biotechnology is clear, but it is not sufficient to focus on these to the exclusion of policy. For it is policy that determines crucial elements such as research funding, incentives for biotechnology commercialization, and even the strength of patent laws.
So, I present this three-part video series to provide an overview of biotechnology policy, to illustrate how policies can promote biotechnology, and to demonstrate the challenges of balancing innovation incentives with economic constraints.
I have created a six-hour biotechnology education series at bit.ly/LfbSdS, and I want to highlight the policy discussion here.
It is easy to ignore policy when operating in biotechnology. The importance of an understanding of the business of biotechnology, of patent and other legal issues, and of the science of biotechnology is clear, but it is not sufficient to focus on these to the exclusion of policy. For it is policy that determines crucial elements such as research funding, incentives for biotechnology commercialization, and even the strength of patent laws.
So, I present this three-part video series to provide an overview of biotechnology policy, to illustrate how policies can promote biotechnology, and to demonstrate the challenges of balancing innovation incentives with economic constraints.
I have created a six-hour biotechnology education series at bit.ly/LfbSdS, and I want to highlight the policy discussion here.
It is easy to ignore policy when operating in biotechnology. The importance of an understanding of the business of biotechnology, of patent and other legal issues, and of the science of biotechnology is clear, but it is not sufficient to focus on these to the exclusion of policy. For it is policy that determines crucial elements such as research funding, incentives for biotechnology commercialization, and even the strength of patent laws.
So, I present this three-part video series to provide an overview of biotechnology policy, to illustrate how policies can promote biotechnology, and to demonstrate the challenges of balancing innovation incentives with economic constraints.
On a recent press tour of New Jersey I was introduced to PTC Therapeutics, a fascinating company that is developing ribosomal readthrough drugs for several indications.
What I find so interesting about this company and their technology is that it is a sort of magic bullet. Drugs that can modulate ribosomal activity can potentially treat hundreds of diseases (indeed, PTC told me that they are looking at thousands of diseases).
Briefly, DNA contains information to construct all the proteins in our bodies. Roughly speaking, proteins are responsible for structural (e.g. muscles, skin, etc.) and chemical (e.g. digesting food, sending and responding to neurotransmitters and hormones, etc.) roles in cells. genes in DNA are transcribed into RNA, which is then translated into proteins (for a more detailed explanation, see this sample chapter from my book, Building Biotechnology).
When genetic information in RNA is being translated into proteins, sometimes there is a premature signal to stop translation. This results in a mal-formed protein which gets only partially interpreted, or discarded. The end result is that key proteins may be missing from individuals with these genetic errors, leading to sometimes terrible diseases. Fortunately, there are multiple signals for translation to stop, and the gene sequence is only one of these signals. So, companies like PTC are finding ways to modulate the activity of ribosomes, the cellular machines which translate RNA into protein, to encourage them to ignore illegitimate stop messages.
Using the DNA-o-gram Generator, I will illustrate what a defective gene looks like, and how ribosomal readthrough can fix it.
The DNA-o-gram generator is a website that uses the principles of the genetic code to encode basic messages written in English into DNA. It can be used to demonstrate different kinds of genetic mutations.
Consider the following DNA sequence:
CAGCTTGACTAAGCGCGTGTTCTTATGGACGCGTAACTCGGCGTCCTTGTG
In the language of the DNA-o-gram generator, it codes for the message:
Regulate glucose levels.
Now, consider what happens when we mutate the code as follows:
CAGCTTGACTAAGTGCGTGTTCTTATGGACGCGTAACTCGGCGTCCTTGTG
The new message is:
Regu.ate glucose levels.
This is called a premature stop, because the period in the middle of the message causes it to get cut-off and destroyed. The result of the mutation in this fictional case might be loss of ability to regulate insulin, resulting in diabetes.
As I mentioned above, there are multiple signals to indicate stop messages, so companies like PTC are developing drugs to encourage ribosomes to address mutations
Another type of mutation is the frameshift mutation, where one or two letters in the DNA sequence is added or removed (the DNA sequence is read in threes). The result is that everything downstream of the mutation is garbled. For example:
CAGCTTGACTAAGCCGCGTGTTCTTATGGACGCGTAACTCGGCGTCCTTGTG
is transcribed as:
Regukl51xnYrHZaW5
These are more prevalent than premature-stop mutations and will likely be far more difficult to resolve, but there are other companies focusing on developing drugs to help ribosomes address frameshifts as well.
What I find most interesting about ribosomal readthrough is that drugs addressing the errors can potential treat multiple diseases. This means that ribosomal readthrough drugs are potential ‘magic bullets,’ with the ability to be used across different conditions.
Prev