I have created a six-hour biotechnology education series at bit.ly/LfbSdS, and I want to highlight the policy discussion here.

It is easy to ignore policy when operating in biotechnology. The importance of an understanding of the business of biotechnology, of patent and other legal issues, and of the science of biotechnology is clear, but it is not sufficient to focus on these to the exclusion of policy. For it is policy that determines crucial elements such as research funding, incentives for biotechnology commercialization, and even the strength of patent laws.

So, I present this three-part video series to provide an overview of biotechnology policy, to illustrate how policies can promote biotechnology, and to demonstrate the challenges of balancing innovation incentives with economic constraints.

On a recent press tour of New Jersey I was introduced to PTC Therapeutics, a fascinating company that is developing ribosomal readthrough drugs for several indications.

What I find so interesting about this company and their technology is that it is a sort of magic bullet. Drugs that can modulate ribosomal activity can potentially treat hundreds of diseases (indeed, PTC told me that they are looking at thousands of diseases).

What is a ribosome, and why do you want it to “readthrough’?

Briefly, DNA contains information to construct all the proteins in our bodies. Roughly speaking, proteins are responsible for structural (e.g. muscles, skin, etc.) and chemical (e.g. digesting food, sending and responding to neurotransmitters and hormones, etc.) roles in cells. genes in DNA are transcribed into RNA, which is then translated into proteins (for a more detailed explanation, see this sample chapter from my book, Building Biotechnology).

When genetic information in RNA is being translated into proteins, sometimes there is a premature signal to stop translation. This results in a mal-formed protein which gets only partially interpreted, or discarded. The end result is that key proteins may be missing from individuals with these genetic errors, leading to sometimes terrible diseases. Fortunately, there are multiple signals for translation to stop, and the gene sequence is only one of these signals. So, companies like PTC are finding ways to modulate the activity of ribosomes, the cellular machines which translate RNA into protein, to encourage them to ignore illegitimate stop messages.

How does readthrough work?

Using the DNA-o-gram Generator, I will illustrate what a defective gene looks like, and how ribosomal readthrough can fix it.

The DNA-o-gram generator is a website that uses the principles of the genetic code to encode basic messages written in English into DNA. It can be used to demonstrate different kinds of genetic mutations.

Consider the following DNA sequence:

 CAGCTTGACTAAGCGCGTGTTCTTATGGACGCGTAACTCGGCGTCCTTGTG

In the language of the DNA-o-gram generator, it codes for the message:

Regulate glucose levels.

Now, consider what happens when we mutate the code as follows:

 CAGCTTGACTAAGTGCGTGTTCTTATGGACGCGTAACTCGGCGTCCTTGTG

The new message is:

Regu.ate glucose levels.

This is called a premature stop, because the period in the middle of the message causes it to get cut-off and destroyed. The result of the mutation in this fictional case might be loss of ability to regulate insulin, resulting in diabetes.

As I mentioned above, there are multiple signals to indicate stop messages, so companies like PTC are developing drugs to encourage ribosomes to address mutations

Another type of mutation is the frameshift mutation, where one or two letters in the DNA sequence is added or removed (the DNA sequence is read in threes). The result is that everything downstream of the mutation is garbled. For example:

 CAGCTTGACTAAGCCGCGTGTTCTTATGGACGCGTAACTCGGCGTCCTTGTG

is transcribed as:

Regukl51xnYrHZaW5

These are more prevalent than premature-stop mutations and will likely be far more difficult to resolve, but there are other companies focusing on developing drugs to help ribosomes address frameshifts as well.

What I find most interesting about ribosomal readthrough is that drugs addressing the errors can potential treat multiple diseases. This means that ribosomal readthrough drugs are potential ‘magic bullets,’ with the ability to be used across different conditions.

This paper is part of the free Open Access archive of the Journal of Commercial Biotechnology

Seeds, food and trade wars: Public opinion and policy responses in the USA and Europe

Go to paper

ABSTRACT: The political debate over genetically modified foods entered a new phase when the USA (under the Bush Administration) threatened legal actions within the World Trade Organization (WTO) against a moratorium of these products in the European Union. This paper focuses on developing a societal context in which these political disputes arose though an investigation of public opinion polls conducted in both the USA and Europe...

The Journal of Commercial Biotechnology is a unique forum for all those involved in biotechnology commercialization to present, share, and explore new ideas, latest thinking and best practices, making it an indispensable guide for those developing projects and careers within this fast moving field.

Each issue publishes peer-reviewed, authoritative, cutting-edge articles written by the leading practitioners and researchers in the field, addressing topics such as:

• Management
• Policy
• Finance
• Law
• Regulation
• Bioethics

For more information, see the Journal of Commercial Biotechnology website

Drug Patent Expirations for January 2014

In the wake of the repositioning of Maryland’s Shady Grove Incubator from biotechnology to cyber security, Virginia has stepped up with a new biotechnology incubator.

The Prince William Science Accelerator, located adjacent to George Mason University, will be the only public-private commercially available property featuring wet laboratory spaces in the Northern Virginia region for the life sciences.

Maryland has long been a stronghold of biotechnology in the DC area, and it will be interesting to see if this repositioning of assets will help drive more biotechnology development in northern Virginia.

This is a guest post from Susan K Finston, President of Finston Consulting. Do you have a response to Susan’s post? Respond in the comments section below.

Last April, I wrote here about the paradox of cancer research funding where over $100 billion in R&D funding for genomic targeting of cancer tumors has yielded only modest gains for cancer patients.   Despite the persistent lack of progress in curing most metastatic forms of cancer, risk averse, sclerotic, funding policies continue to throw good money after bad.  As Nobel laureate Jim Watson points out:

“Targeted biological therapies don’t kill cancer cells, they are not curing cancer and it is unlikely that they can be made to do so in a practical or comprehensive way in the near future. It’s time for a change in strategy. We know the current approach is not working, because on the whole it has made no dent in cancer mortality.”

Now it looks like there is at least modest attention  being given to an alternative approach to cancer R&D relating to the critical tumor suppressor protein, p53 (also cited by Watson).

Professor Sir David Lane first discovered the p53 protein in 1979, dubbing it “the guardian of the genome,” for the important role the protein plays in monitoring  health of cells and preventing cancer.  Mutation or deletion of p53 is highly correlated with growth of a majority of human tumors, and up to 90% of tumors for some cancer sub-categories like ovarian cancer. Overall, Lane asserts that “nearly every tumor has an affected or moderated p53 pathway,”

Finding ways to reactivate the key p53 protein has long been considered one of the ‘holy grails’ of cancer research.  Now as reported by the New York Times, a number of the largest bio-pharma companies –  including Roche, Merck, and Sanofi – are working actively on therapeutic approaches relating to reactivation of the p53 protein and effective against a range of cancer tumors.

Although not mentioned in the New York Times Article, a much smaller company,  Cellceutix, may have the most promising p53 compound currently in human clinical trials at Harvard’s Dana Farber Cancer Center and Beth Israel Deaconess Medical Center.

Additional academic and bio-pharma start-ups also are pursuing p53 therapies at various stages of discovery and pre-clinical research.

These new therapies all focus on reactivation of the critical p53 tumor suppressor protein, responsible for controlling cell death and long recognized as the archetype of a molecular defect commonly associated with cancer tumors.  If successful, this approach to develop “guardian of the genome” therapies would be a major departure from the genetic typing of tumors to a more holistic approach across cancer sub-types.

Renewed focus on p53 tumor suppressor therapies could truly be the start of a new golden age of cancer R&D that would bring more meaningful benefits to patients in the United States and globally – and coming not a moment too soon!

About the author:
President of Finston Consulting LLC since 2005, Susan works with innovative biotechnology and other clients ranging from start-up to Fortune-100, providing support for legal, transactional, policy and “doing business” issues. Susan has extensive background and special expertise relating to intellectual property and knowledge-economy issues in advanced developing countries including India and South Asia, Latin America and the Middle East North Africa (MENA) region. She also works with governments, and NGOs on capacity building and related educational programs through BayhDole25. Together with biotechnology pioneer Ananda Chakrabarty, she also is co-founder of Amrita Therapeutics Ltd., an emerging biopharmaceutical company based in India with cancer peptide drugs entering in vivo research. Previous experience includes 11 years in the U.S Foreign Service with overseas tours in London, Tel Aviv, and Manila and at the Department of State in Washington DC. For more information on latest presentations and publications please visit finstonconsulting.com.

The Journal of Commercial Biotechnology is published by BiotechBlog’s producer, thinkBiotech.

Journal of Commercial Biotechnology Volume 20, Number 1

Russia-Focused Venture Capital Supports In-Bound Technology Transfer and Company Building: An Analysis of Investment Trends and Outcomes
John M. Garvey, Shann Kerner, Axel Tillmann, Dmitry Kuzmin
This paper analyzes the approaches taken by the Russian government to promote innovation in the biotechnology sector within the country.  Russia is economically strong, currently with a trade surplus, and the country is investing broadly in initiatives that have resulted in in-bound technology transfer, as well as an expansion of the private sector…
Full details at the Journal of Commercial Biotechnology

Funding biotech start-ups in a post-VC world
William Bains, Stella Wooder, David Ricardo Munoz Guzman
Investment in start-up biotech. companies outside the USA has essentially disappeared. VC investment in biotechnology and healthcare as a whole has nearly returned to pre-2008 levels, but almost all is in later stage opportunities. But companies continue to be founded, and continue to flourish. We examine the VC investment patterns for the past 7 years, and show that a start-up today can expect little VC support…
Full details at the Journal of Commercial Biotechnology

Biotechnology Venture Investing and Neurodegenerative Medicine: Promise of New Approaches to Cure an Ailing Model
Dushon DeVere Riley, Mark Cochran
Neurodegenerative diseases are one of the leading public health challenges of the next 50 years. Pharmaceutical therapies have traditionally targeted the later stages of neurodegenerative diseases; however, this strategy – as the recent failures of clinical trials for Alzheimer’s drugs have highlighted – has been unsuccessful…
Full details at the Journal of Commercial Biotechnology

A biological battlefield: The potential applications of using remote sensing technology and biomarker organisms for identifying, tracking, and differentiating persons of interest within an area of operations
Jason Rivera
Since World War II, the majority of American wartime engagements have been characterized by a series of low-intensity, asymmetric conflicts. These conflicts have increased the importance of understanding the dynamics of individual actors within complex battlespaces which in turn has led U.S. military commanders, intelligence professionals, and wartime decision makers to seek a variety of means for identifying, tracking, and differentiating persons of interest…
Full details at the Journal of Commercial Biotechnology

How a large biotechnology company teamed with a translation service provider to define best practices
Jeremy Coombs
According to the World Intellectual Property Organization, nearly 100,000 pharmaceutical and biotechnology patent applications are filed each year around the world, and the trend is increasing. These companies have very little room for error in the work they conduct each day. As a result, the translations of these patent applications need to be completely accurate, which requires a translation service provider who follows best practices…
Full details at the Journal of Commercial Biotechnology

A Social Media Manifesto
Peter J. Pitts
The role of marketing communications is to advance the bottom line and the public good – and not necessarily in that order. Giving back is an integral part of the New Normal. And there has never been a better tool to accomplish this mission than social media…
Full details at the Journal of Commercial Biotechnology

Raw materials intended to be used for Gene, Cell and Tissue therapies: legal and regulatory considerations
Sophie Bisson
This paper offers some insights on the European regulatory situation with respect to raw materials used in production of gene, cell and tissue therapy products, including advanced therapy medicinal products. By focusing on the existing EU and French rules, the purpose of this paper is to review the content and scope of the measures restricting their placing on the market and/or use, the legal implications and hence key challenges ahead…
Full details at the Journal of Commercial Biotechnology

EU Legal & Regulatory Update
Ewan Grist

Full details at the Journal of Commercial Biotechnology

This paper is part of the free Open Access archive of the Journal of Commercial Biotechnology

Mergers and acquisitions: A consideration of the drivers and hurdles

Go to paper

ABSTRACT: Mergers and acquisitions (M&A) are increasingly being included by biopharmaceutical companies within earlier stage strategies as a means of accelerating technology development and thus quickening the path to shareholder value. These drivers are generally different from those of the larger established pharmaceutical companies that are more earnings focused...

The Journal of Commercial Biotechnology is a unique forum for all those involved in biotechnology commercialization to present, share, and explore new ideas, latest thinking and best practices, making it an indispensable guide for those developing projects and careers within this fast moving field.

Each issue publishes peer-reviewed, authoritative, cutting-edge articles written by the leading practitioners and researchers in the field, addressing topics such as:

• Management
• Policy
• Finance
• Law
• Regulation
• Bioethics

For more information, see the Journal of Commercial Biotechnology website

Drug Patent Expirations for December 2013

This is a guest post from Susan K Finston, President of Finston Consulting. Do you have a response to Susan’s post? Respond in the comments section below.

My thoughts have been returning to biotechnology in Israel and how it has benefited from the state’s exceptional technology linkages.

Just ten years ago, innovative life sciences was the lagging indicator in the country’s long-running technology boom.  Bio-pharmaceutical companies in particular expressed concerns about Israel’s commitment to provide effective data exclusivity – protection for commercially valuable dossiers submitted to regulators as a condition for gaining marketing approval – and other lacunae in the outdated patent law.  In the early 2000’s, FDI in innovative bio-pharma R&D stagnated, and Israel lost luster as a clinical research destination.

Much has happened on the IP front in the last 5 years:  In 2009, the World Intellectual Property Organization (WIPO) appointed the Israeli Patent Office as an International Searching and Preliminary Authority under the PCT, in recognition of Israel’s technology prowess.  Under pressure abroad and at home, Israel initiated substantial reforms for harmonization its IP regime with international norms. This year Israel seeks to complete the legislative process this year for pending bills to address remaining key concerns relating to patent term extension.

All the while, Israel has excelled at IP management from a technology transfer perspective.  Effective technology transfer pre-dates Israeli independence, and has been carried forward by the Weizman Institute, Technion and other technology powerhouses across the country. (I wrote more about the foundational nature of tech transfer for Israel for the Biotechblog last February, here.)

Technology linkages supporting Israel’s biotech boom are captured in the 2013 US-Israel Innovation Index, released last week here in Washington DC.  The 2013 Index measures how Israel stacks up against a range of comparator countries, including Switzerland, Canada, Singapore, Germany, Sweden, South Korea, Finland, Japan, Turkey, Brazil and Russia, in descending rank.   Indicators include government support for innovation, the level of intensity of private sectors / industry activity, human capital and overall R&D.  Despite its small size – both geographically and in population – Israel ranks with Canada and is outpaced only by Switzerland.   Data sources and an annex with the data itself are available online.

Although it is not addressed directly in the 2013 Index, access to capital is another interesting factor that sets Israel apart from the rest of the Middle East / North Africa (MENA) region.  As measured by the OECD, Israel provides perhaps the most vibrant pool of VC funding outside the United States.   Moreover, Israeli VCs continue to place funds in early stage companies.

Israel’s biotech boom began with medical devices, where Israeli innovators were able to leverage IT technologies for novel Health Information Technologies (HIT).

Overall, the number of life-science companies has grown from 186 in 1996 to more than 1,100 in 2012, in a state with a population of only 7 million people. 

Most biotech funding still goes into medical devices, where the risk and development time is more favorable as compared to pure bio-pharma. Still, an increasing number of Israel’s most exciting biotechnology companies focus purely on novel therapies targeting unmet medical needs. I have met some of these pioneers and they are impressive. Their success or failure may determine the future path of biotechnology in Israel.

About the author:
President of Finston Consulting LLC since 2005, Susan works with innovative biotechnology and other clients ranging from start-up to Fortune-100, providing support for legal, transactional, policy and “doing business” issues. Susan has extensive background and special expertise relating to intellectual property and knowledge-economy issues in advanced developing countries including India and South Asia, Latin America and the Middle East North Africa (MENA) region. She also works with governments, and NGOs on capacity building and related educational programs through BayhDole25. Together with biotechnology pioneer Ananda Chakrabarty, she also is co-founder of Amrita Therapeutics Ltd., an emerging biopharmaceutical company based in India with cancer peptide drugs entering in vivo research. Previous experience includes 11 years in the U.S Foreign Service with overseas tours in London, Tel Aviv, and Manila and at the Department of State in Washington DC. For more information on latest presentations and publications please visit finstonconsulting.com.