Home Authors Posts by thinkBiotech

thinkBiotech

605 POSTS 21 COMMENTS

This spring has been a busy one for book launches — I have one final book to announce: The Success Matrix.

The Success Matrix: Winning in Business and in Life takes a slightly different approach than most business books.the-success-matrix_150px

A typical business book guides the reader through its prescribed methods and tools, using various real world examples to support its concepts and conclusions. In fact, the central chapters of The Success Matrix do just that. But The Success Matrix is atypical in the opening and closing chapters. In these chapters the author conveys the basic concepts of the book in a format that should be more accessible and recognizable to readers who are themselves executives, managers, entrepreneurs or individual contributors: a fictional account of one executive’s exposure to The Success Matrix, as explained to him by his friend and mentor.

Bracketing deep management insights with a fictional story to illustrate the power of the concepts within, The Success Matrix demonstrates how, by focusing on the balance across three areas — Vision, Process, and Output, you can improve your business performance as well as satisfaction in your world outside of work. It’s a fun, easy read, but with serious impact in your business, your career and your personal life.

See more details, and buy the book at Amazon.com

Susan Kling FinstonThis is a guest post from Susan K Finston, President of Finston Consulting. Do you have a response to Susan’s post? Respond in the comments section below.

Looking at the increasing therapeutic importance of peptide therapies,  you may be surprised to learn that these (literal) building blocks of proteins have been defined away under the The Biologics Price Competition and Innovation Act of 2009 (BPCI Act), and don’t get twelve (12) year period of data exclusivity for biologics and protein products.  To learn more, read on.

Over the past decade, peptide therapies have crossed over into the mainstream with over 60 approved products, 140 therapies in the clinic and an estimated 500 – 600 in preclinical development. Indications for peptide drugs also are broadening, ranging from infectious disease, to metabolic disorders and advanced cancer therapies. With less toxicity and fewer side effects, naturally occurring peptide drugs have an approval rate that is double that of small molecules (new chemical entities or NCEs).

Why are peptide drugs so important?

“Evolution has been honing the specificity of polypeptides for millions of years. Amino Acid sequences – whether in peptides or proteins – control and direct all aspects of cellular functioning and coordinate most intercellular communication. No other class of biological molecules offers the range of chemical diversity … they are nature’s toolkit and the more we can use native peptides or closely related analogs , the safe and more specific the drugs at the physician’s disposal.” (Source: Rodney Lax)

With emerging nanotechnologies, we are seeing breakthrough products like oral insulin, along with a range of critical new therapeutic approaches including peptide cancer therapies for oral delivery and on an out-patient basis, up to and including anticipation of effective cancer prophylaxis for patients with BRCA mutations. Convergence of nanotechnologies with increased understanding of peptides makes everything possible.

Understanding the greater development and manufacturing challenges associated with biologics, the FDA’s understandable preference is for shorter, truncated, peptides that can be manufactured through chemical synthesis. This entails a time-consuming and painstaking process of optimizing and abbreviating peptide drugs to reduce the size from 50, 40, or 30 peptides to a smaller size can be synthesized chemically for hospital use (IV delivery) or as oral formulations (nanotechnology).

So while avoiding the risks and challenges of biologics, peptide therapies are inherently more complex than typical small chemical entities. Months or even years of additional development time may be needed to fully optimize a truncated peptide that will retain safety and effectiveness as a drug, comprising smallest possible amino acid chain for submission to the FDA.

Given lengthier product development cycles, increased patent litigation, greater complexity of clinical trial requirements and the new regulatory pathway for biosimilars, the U.S. Government mandated an increased data exclusivity period for biotech drugs generally. The BCPI Act included a 12 year period of exclusivity for regulatory dossiers associated with biologicals and protein products.

You may think that this includes peptide drugs – that would be logical. In fact, the opposite is true. Based on the (revised) definition and FDA guidance to the BPCI Act, peptide drugs that navigate the Scylla and Charybdus of biologics and small molecule development and gain FDA approval expressly are excluded from the 12 year period of exclusivity available for biologics.

This brings to mind President Lincoln’s famous riddle:

“If you call the tail a leg, how many legs does a horse have?

Four – calling a tail a leg does not make it a leg.”

As the building blocks of proteins, technology-intensive peptide therapies are essentially biologic in nature – and well deserving of 12 years of data exclusivity.

About the author:
President of Finston Consulting LLC since 2005, Susan works with innovative biotechnology and other clients ranging from start-up to Fortune-100, providing support for legal, transactional, policy and “doing business” issues. Susan has extensive background and special expertise relating to intellectual property and knowledge-economy issues in advanced developing countries including India and South Asia, Latin America and the Middle East North Africa (MENA) region. She also works with governments, and NGOs on capacity building and related educational programs through BayhDole25. Together with biotechnology pioneer Ananda Chakrabarty, she also is co-founder of Amrita Therapeutics Ltd., an emerging biopharmaceutical company based in India with cancer peptide drugs entering in vivo research. Previous experience includes 11 years in the U.S Foreign Service with overseas tours in London, Tel Aviv, and Manila and at the Department of State in Washington DC. For more information on latest presentations and publications please visit finstonconsulting.com.

worldview-5-yearsSix years ago I built a global biotechnology innovation index, and I have been using it since tracking global biotechnology innovation in Scientific American’s Worldview. It has been a very rewarding project, and I have enjoyed the opportunity to present my research data at international conferences, business schools, and even National Defense University.

Some of the issues I am focusing on this year are economic recovery, agricultural biotechnology, and global biotechnology workforce intensity and mobility.

I am always looking for feedback on the index and new data sets to help expand it. I invite you to visit the scorecard at http://www.saworldview.com/wv/scorecard/ and send me your suggestions and feedback.

Ananda-Chakrabarty-Bugging-Cancer_300x477The 1980 Supreme Court case of Diamond v. Chakrabarty was transformative for the biotechnology industry. It saw the Supreme Court allow Ananda Chakrabarty’s patents on living organisms, and paved the way for commercial biotechnology.

Decades later, Chakrabarty is still an active researcher, and he is now working to develop cancer therapeutics based on symbiotic bacteria. In Bugging Cancer, Chakrabarty and his colleagues at the Chicago Oncogroup have written a compelling dramatic thriller that portrays a fictional story based on this real-life work.

Bugging Cancer is a fictional book, based on real scientific progress in using bacteria and bacterial proteins to attack malignant tumor cells. Scientific results are extended in a fictional way to describe the cancer-fighting power of an imaginary bacterial protein termed neelazin. The book also mirrors present-day issues, including international competition for scientific talent, issues in patent law, research ethics, and financing.

Written by a team of seasoned scientific and business professionals, Bugging Cancer is sure to appeal to scientific researchers, patent attorneys, physicians, and any anyone else interested in healthcare and scientific innovation.

See more details at the book’s homepage, or buy it at Amazon.com

In a recent post at In the Pipeline, Derek Lowe answers a reader’s question about how best to promote drug discover in India. Given my research on the matter, I figured I would try and provide an answer as well.

In Scientific American’s Worldview, I have been ranking national biotechnology industries for the past five years. When I was recently in New Delhi I presented the Indian innovation figures and asked the audience to guess where they ranked. Much to their amazement, India was ranked with the bottom five of the 50+ countries assessed. The issues are myriad — poor patent protection, infrastructure problems, an insufficient quantity (not quality!) of skilled workers, etc.

Compounding this issue, I also refer back to my study on pharmaceutical globalization (see also peer-reviewed publication). When studying the locations of pharmaceutical patent inventors since 2000, I was surprised to find that it had essentially never moved — The US, Western Europe, and Japan have and still do dominate pharmaceutical invention. This is a sobering finding for any region (either a country or even a province/state within one) seeking to improve their drug discovery output. It is notoriously hard to seed new locations.

So, where does that leave India and every other country that doesn’t have strong drug discovery? Should they simply give up? Clearly that is not a good plan, and it is also not practical because of the strong social, economic and political benefits that come from drug discovery. Rather, I think that countries seeking to develop drug discovery capacity should focus first on building foundations for drug discovery, and this is often best done by not working on drugs!

One of the problems with providing stimulus to foster novel drug development firms is that, if successful, the talent, products, and profits often move to one of the established drug development hubs. It is akin to trying to build an broadcast entertainment industry outside Hollywood or developing a sports team in a new city — if you do develop talent, much of it will be drawn to the existing hubs.

So, given that successfully developing drugs outside of existing hubs has been shown to be rare, and that any products and talent developed outside of existing hubs is also likely to relocate to existing hubs, what can be done? I think that a better approach is to focus on uniquely domestic needs, which can be later adapted to serve broader problems.

Brazil is a world leader in bioethanol production. This capacity was developed with the initial help of tax subsidies, but it also followed a natural path — sugarcane processing. In Brazil bioethanol is produced by fermentation of bagasse, which is the pulpy sugarcane plant mass left behind after sugar extraction. Because bagasse was already collected at sugar processing plants, biomass producers simply had to set up shop at the collection points. Furthermore, because bagasse is expensive to ship, it means that the bioethanol companies are likely to stay local.

To come back to the Indian example, it is important to recognize that drugs are but one way to improve health. Another way is to prevent disease. When I was in New Delhi, holidays were providing a respite from smog as farmers upwind from Delhi had temporarily stopped burning crop residues. Investments in industrial or agricultural biotechnology applications to provide alternatives to burning crop residues can improve rural employment while reducing pollution and pollution-borne illnesses. These domestic solutions are unlikely to relocate, and can build a foundation for further development in other areas, such therapeutic biotechnology.

SteveSapletalThis is a guest post by Steve Sapletal,  a director in West Monroe Partners‘ M&A practice. Do you have a response to Steve’s post? Respond in the comments section below.

Reorganize, realign, refocus: When divesting is the key to improving margins and profitability

Large medical device companies have been buying complementary businesses over the last five to seven years in order to grow the bottom line while achieving better margins and improving profitability. But, while these organizations have been quick to acquire, many have since realized that operating these complementary organizations requires an entirely different business focus, customer support and operating model. Sometimes, this realization comes too late, resulting in employee and customer retention issues, shrinking revenues and profit margins instead of the bottom line growth and collaborative opportunities the deal promised initially. In these instances, large medical device companies’ best bet is to consider consolidating operations or selling non-strategic parts of their business to refocus on their core operations.

One organization doing just that is Quest Diagnostics. In late 2012, Quest Diagnostics announced that it would launch “a major management restructuring aimed at driving operational excellence and restoring growth.” This restructuring was intended to simplify the organization by divesting non-core and underperforming assets and refocusing capital deployment.  Since then, Quest Diagnostics has reorganized numerous times, shuffled many of its products and services, realigned employees, eliminated duplicative roles and layers of management and adopted a simple “back to basics” approach.  Quest has also sold parts of the business, including HemoCue, to shift attention back to its core operations in diagnostic information services.

Divesting companies takes time, energy and resources and has an immediate impact on profitability. But, it also allows medical device companies like Quest to dedicate the right resources and capital to its strategic objectives going forward. It is a tough decision to divest a portion of the business, especially given shareholder pressures to increase share value, but is often the right one for medical device companies looking for long-term survival and prosperity in an industry ripe with competition.

When should a large medical device company consider refocusing on core operations?

Acquisitions always look good on paper and in a financial model, but achieving full integration and deal value is not a paper exercise.  When completing multiple deals within a year, organizations tend to experience new layers of management and reporting structures, duplicate core IT systems and redundant business processes. After a period of high transaction activity, Quest realized that it had three extra layers of management between the CEO and front line employees that were unnecessary –representing between 400 and 600 employees – far beyond what one would deem a well-run organizational model.

Additionally, Quest, like many of its peers, had to respond to new market pressures regarding reimbursement for laboratory diagnostic services by shuffling their product and services portfolios to stay profitable.  Internally, Quest needed to simplify operations and improve processes to be able to respond more quickly to customer requests and make decisions faster. Many of these bottlenecks were the result of previously acquired businesses not being fully integrated into overall operations. While there is never a perfect time to go through the process of refocusing your business, waiting too long to consolidate or divest can ultimately stunt your business’s growth in the long-term.

What’s next?

Selling business units and consolidating divisions doesn’t guarantee operational excellence. Putting the right organizational structure in place is only step one towards achieving your strategic objectives. From there, medical device companies should pay careful attention to broken, inefficient or outdated systems and technologies. Address these problem areas to ensure they promote productivity and design the right processes to complement these systems. Careful planning is important, but successful execution is vital.

Look for Quest to spend a large chuck of time, resources and dollars to stabilize the business before strategically buying another large business outside of its core competency.

About the guest-author:

Steve Sapletal is a director in West Monroe’s M&A practice. He can be reached at ssapletal@westmonroepartners.com.

I have created a six-hour biotechnology education series at bit.ly/LfbSdS, and I want to highlight the policy discussion here.

It is easy to ignore policy when operating in biotechnology. The importance of an understanding of the business of biotechnology, of patent and other legal issues, and of the science of biotechnology is clear, but it is not sufficient to focus on these to the exclusion of policy. For it is policy that determines crucial elements such as research funding, incentives for biotechnology commercialization, and even the strength of patent laws.

So, I present this three-part video series to provide an overview of biotechnology policy, to illustrate how policies can promote biotechnology, and to demonstrate the challenges of balancing innovation incentives with economic constraints.

I have created a six-hour biotechnology education series at bit.ly/LfbSdS, and I want to highlight the policy discussion here.

It is easy to ignore policy when operating in biotechnology. The importance of an understanding of the business of biotechnology, of patent and other legal issues, and of the science of biotechnology is clear, but it is not sufficient to focus on these to the exclusion of policy. For it is policy that determines crucial elements such as research funding, incentives for biotechnology commercialization, and even the strength of patent laws.

So, I present this three-part video series to provide an overview of biotechnology policy, to illustrate how policies can promote biotechnology, and to demonstrate the challenges of balancing innovation incentives with economic constraints.

I have created a six-hour biotechnology education series at bit.ly/LfbSdS, and I want to highlight the policy discussion here.

It is easy to ignore policy when operating in biotechnology. The importance of an understanding of the business of biotechnology, of patent and other legal issues, and of the science of biotechnology is clear, but it is not sufficient to focus on these to the exclusion of policy. For it is policy that determines crucial elements such as research funding, incentives for biotechnology commercialization, and even the strength of patent laws.

So, I present this three-part video series to provide an overview of biotechnology policy, to illustrate how policies can promote biotechnology, and to demonstrate the challenges of balancing innovation incentives with economic constraints.

On a recent press tour of New Jersey I was introduced to PTC Therapeutics, a fascinating company that is developing ribosomal readthrough drugs for several indications.

What I find so interesting about this company and their technology is that it is a sort of magic bullet. Drugs that can modulate ribosomal activity can potentially treat hundreds of diseases (indeed, PTC told me that they are looking at thousands of diseases).

What is a ribosome, and why do you want it to “readthrough’?

Briefly, DNA contains information to construct all the proteins in our bodies. Roughly speaking, proteins are responsible for structural (e.g. muscles, skin, etc.) and chemical (e.g. digesting food, sending and responding to neurotransmitters and hormones, etc.) roles in cells. genes in DNA are transcribed into RNA, which is then translated into proteins (for a more detailed explanation, see this sample chapter from my book, Building Biotechnology).

When genetic information in RNA is being translated into proteins, sometimes there is a premature signal to stop translation. This results in a mal-formed protein which gets only partially interpreted, or discarded. The end result is that key proteins may be missing from individuals with these genetic errors, leading to sometimes terrible diseases. Fortunately, there are multiple signals for translation to stop, and the gene sequence is only one of these signals. So, companies like PTC are finding ways to modulate the activity of ribosomes, the cellular machines which translate RNA into protein, to encourage them to ignore illegitimate stop messages.

How does readthrough work?

Using the DNA-o-gram Generator, I will illustrate what a defective gene looks like, and how ribosomal readthrough can fix it.

The DNA-o-gram generator is a website that uses the principles of the genetic code to encode basic messages written in English into DNA. It can be used to demonstrate different kinds of genetic mutations.

Consider the following DNA sequence:

 CAGCTTGACTAAGCGCGTGTTCTTATGGACGCGTAACTCGGCGTCCTTGTG

In the language of the DNA-o-gram generator, it codes for the message:

Regulate glucose levels.

Now, consider what happens when we mutate the code as follows:

 CAGCTTGACTAAGTGCGTGTTCTTATGGACGCGTAACTCGGCGTCCTTGTG

The new message is:

Regu.ate glucose levels.

This is called a premature stop, because the period in the middle of the message causes it to get cut-off and destroyed. The result of the mutation in this fictional case might be loss of ability to regulate insulin, resulting in diabetes.

 

As I mentioned above, there are multiple signals to indicate stop messages, so companies like PTC are developing drugs to encourage ribosomes to address mutations

Another type of mutation is the frameshift mutation, where one or two letters in the DNA sequence is added or removed (the DNA sequence is read in threes). The result is that everything downstream of the mutation is garbled. For example:

 CAGCTTGACTAAGCCGCGTGTTCTTATGGACGCGTAACTCGGCGTCCTTGTG

is transcribed as:

Regukl51xnYrHZaW5

These are more prevalent than premature-stop mutations and will likely be far more difficult to resolve, but there are other companies focusing on developing drugs to help ribosomes address frameshifts as well.

What I find most interesting about ribosomal readthrough is that drugs addressing the errors can potential treat multiple diseases. This means that ribosomal readthrough drugs are potential ‘magic bullets,’ with the ability to be used across different conditions.